DRSC/TRiP Functional Genomics Resources

UP-TORR - Updated Targets of RNAi Reagents

Help

UP-TORR search options

Note: Maximum rows of search input:500. For a report of all reagents, use the
"All-Reagent On-Target" and "All-Reagent Off-Target" download options on the Fly and Worm pages.

Option 1: Enter the sequence(s) of RNAi reagent(s)

You need to select the species first and then enter RNAi sequence with ID.

For example:

1      GCGGCGGTTAACAATACCGAA

2      GCGGCGGTTAACAATACCGAA

3      GCGGCGGTTAACAATACCGAA

4      TTTTTGTTTGTTTTACTCCGA

5      CTGGTTATACCAGGACATTGA

The 1 st column is user-specificied RNAi reagent ID and the 2nd column is the gene-specific sequence of RNAi reagent.

Option 2: Enter the primer sequences for dsRNA reagent(s)

You need to select the species first and then enter primer-pair sequence with ID.

For example:

1      ATCTGCTGCTGCAGGTTC                   GCCAACTATCAGTTCCCAAC

2      CTCATCATTTATAAGATGGTCAC      AAATGAAAAACAAGTTCAAACTG

3      TTTCTTTGTCCTCCTTATTCTTC          GAACCCGCCACCCTATGA

4      ATATGTGGGCTATAGCGAAAT         CAGAACACGGCCGACAC

5      GTTTTTTTTCCCCTCCATCTTT            GAGTGGGCAAAGTACAAGAT

6      GACGCTGCTTATCTTCCTGG             CTTGGTCTTCTTGCCAAAGC

The 1 st column is user-specified RNAi reagent ID.

The 2nd column is the gene-specific sequence of first PCR primer.

The 3rd column is the gene-specific sequence of second PCR primer.

Option 3: Enter RNAi reagent ID(s) from the following resources.

DRSC amplicon (DRSC amplicon ID)

DKFZ amplicon (BKN amplicon ID)

TRiP transgenic fly (stock ID or hairpin ID)

NIG transgenic fly (stock ID)

VDRC transgenic fly (transformant ID)

For example:

JF02592

DRSC32366

DRSC32367

HMS00794

JF01257

30044R-1

BKN20541

Option 4: Enter gene identifier(s) to query the available fly RNAi reagents such as FlyBase gene identifier and gene symbol.

For example:

wg

s-cup

RpL27

FBgn0003996

CG10006

Option 5: Enter sequence(s) and query all the fly RNAi reagents that target these sequence(s)

For example:

>wg exon2

GGGCATTGCCAAGGTCGGCGAACCCAACAACATTACGCCCATCATGTACA

TGGACCCAGCGATCCACTCTACGTTGAGAAGGAAACAGCGACGCCTGGTC

AGGGACAATCCCGGTGTACTGGGAGCCCTGGTCAAGGGCGCCAACTTGGC

CATTAGCGAGTGCCAACACCAGTTCAGAAATCGCCGCTGGAACTGCTCGA

CGAGAAACTTCTCGAGGGGCAAAAATCTATTCGGCAAAATCGTTGATCGA

G