The pCFD3 and pCFD4 vectors (Port, Chen, Lee, & Bullock, 2014) are designed to express either one or two sgRNAs, respectively, in Drosophila melanogaster. Both vectors contain attB sites for PhiC31-recombination, as well as the vermillion selection marker. In pCFD3, the single sgRNA is driven by the U6:3 promoter (the strongest of the three U6 promoters tested for this purpose), and in pCFD4 the sgRNAs are driven by U6:1 and U6:3. Detailed descriptions for cloning sgRNAs into these vectors are available at CRISPR fly design.
The pCFD4-MS2 vector is modified for expressing sgRNAs containing two MS2 sites in the scaffold in order to recruit additional effector protein domains to the dCas9:sgRNA complex and is compatible with the Synergistic Activation Mediator (SAM) system for CRISPRa (Konermann et al., 2015).
To clone sgRNAs into pCFD4-MS2, we follow the same principal as described for pCFD4, except that the following oligos should be ordered:
>pCFD4-MS2 F primer TATATAGGAAAGATATCCGGGTGAACTTC(G)------------------- 5' binding section G-N19/20 3' binding section >pCFD4-MS2 R primer GTGATCCTCATGTTGGCCTAGCTCTAAAAC--N19-20revcomp---(C)GACGTTAAATTGAAAATAGGTC 5' binding section G-N19/20 3' binding section
Similar to the pCFD3 vector, the pl100 vector (Kondo and Ueda 2013) is designed to express a single sgRNA in Drosophila melanogaster from the U6:2 promoter, which drives expression at lower levels than either U6:1 or U6:3 (Port et al. 2014). This vector contains an attB site and a vermillion selection marker. A cloning protocol for pl100 can be found in Housden et al. 2014.
Pl18 ubiquitously expresses Cas9 from the actin promoter and a single sgRNA from the U6:2 promoter (Housden et al. 2015, Housden et al. 2014). This vector is designed for use in cell culture and does not contain attb or p-element transformation sequences. A cloning protocol for pl18 can be found in Housden et al. 2014.