Off-Target Search Tool and Primer Design

Off-Target Search Tool

• The Off-Target Search Tool can be used to submit a sequence and determine its off-targets (and primary target).
• You can copy & paste any sequence that you'd like so long as it is Fasta format. Fasta format is like this:

        >Some Random Text Here
        AGCTAGCTAGCTAGCTACGTACGTACGTACGTACGTACGTAACGT
        AGCTAGCTAGCTAGCTACGTACGTACGTACGTACGTACGTAACGT
        AGCTAGCTAGCTAGCTACGTACGTACGTACGTACGTACGTAACGT
        >Here is my second sequence
        AGCTAGCTAGCTAGCTACGTACGTACGTACGTACGTACGTAACGT
        AGCTAGCTAGCTAGCTACGTACGTACGTACGTACGTACGTAACGT
        AGCTAGCTAGCTAGCTACGTACGTACGTACGTACGTACGTAACGT

• Sequences may also be directly submitted via the Sequence Extraction Tool.
• The Off-Target search tool uses fly gene transcripts to determine primary and off targets. You may set the off-target size as low as 16 bp.
• The tool will return a marked-up sequence with black text representing sequence that targets no genes, blue text representing sequence that targets the primary target gene, and red text representing sequence that has one or more off-targets.
• The tool also provides off-target-free sequence to use for copying & pasting.

Designing New Primers with the Amplicon Design Tool

• The Amplicon Design Tool can be used to design new primers. Internally, it uses Primer3 to do the actual primer picking. Also, this tool only works for the design of amplicons that target fly genes.
• To use the tool, a gene sequence must be provided. One option is to copy & paste one or more sequences in Fasta format as described above.
• The other option is to provide a fly gene symbol or FBgn. If this option is used, the user will be provided a choice of which exon(s) of that gene to design the amplicon against.
• The Off-Target Size option indicates the minimum size of off-targets to avoid in the design of the amplicon. If the number chosen is too low, it may not be possible to design an amplicon.
• The Primer Pair Penalty is a stringency score for Primer3. The lower this number the more stringent the requirements for primer calling. This score takes in to account GC content, self-annealing, melting temperature, primer dimer formation and so on.
• When the primers are returned, their location in the query sequence will be indicated in color-coded boxes. Since different primer pairs often overlap, the colors might be blended.
• Also, there will be a table that indicates the number of genomic locations of the primer sequence and its propensity for mispriming. Obviously, the number of genomic locations is ideally 1 and the misprime score should be as low as possible.

Designing New Primers with E-RNAi

• E-RNAi is another primer-pair design program available on the web.
• It has the advantage that it has that it does a calculation of RNAi efficiency.
• However, it is not as strict about the presence of off-targets as the DRSC tool.