Two formats of either text file or excel file are accepted as input. 1. Input file contains sequence identifiers and sequences (space, tab, comma or semicolon separated) 1.1 Sample file without PAM sequence1 CGCCGGCACCGCGTCCCTAT sequence2 ACGCGCACGGGTCTCACGCC seqeunce3 AGTCCTCACCGTGGGGCACC sequence7 TCGTACCGCACCGGTATTTT sequence8 GAACTCCGACTAGATTATAT sequence9 TGCGGTCGCGTGAGAAATAT sequence4,GTGTCCAGGCTCGTCATGCC sequence5,CTGCCGTTCTTCAGAAATAT sequence6,TTCCTTCATCTCGGTATTAA sequence10;GCACCCTGCACGAATTATTT sequence11;GCCCGAAAGACACGTTTTTT sequence12;TTTGCCTTGGATCGATATAG 1.2 Sample file with PAM (if users indicate that input includes PAM sequences, the tool will exclude the last three bases from the analysis). sequence1 CGCCGGCACCGCGTCCCTATAGG sequence2 ACGCGCACGGGTCTCACGCCTGG sequence3 AGTCCTCACCGTGGGGCACCCGG sequence4 GTGTCCAGGCTCGTCATGCCCGG 2. Input file contains sequences only 2.1 Sample file without PAM TGCGGTCGCGTGAGAAATAT GCACCCTGCACGAATTATTT GCCCGAAAGACACGTTTTTT TTTGCCTTGGATCGATATAG 2.2 Sample file with PAM (if users indicate that input includes PAM sequences, the tool will exclude the last three bases from the analysis) TGCGGTCGCGTGAGAAATATTGG GCACCCTGCACGAATTATTTCGG GCCCGAAAGACACGTTTTTTTGG TTTGCCTTGGATCGATATAGCGG