Reagents and Results:
|
|
|
|
Cell Screening dsRNAs (1)
|
|
|
|
|
|
Hits in 3 of 88 screens (Click title to view all hits in that screen)
|
|
|
|
Flockhouse Virus
|
|
Comparison of GPCR Induced vs. Small G-Protein Induced Signalling to the Nucleus (pmid: 23177739 )
|
|
Identification of genes involved in juvenile hormone signaling through genome-wide RNA interference screening in Drosophila cells
|
|
General dsRNA/Amplicon Information
|
|
|
| Amplicon ID: |
DRSC04664 |
Sequence: |
TCGGAGTAGCGCGGCGGAATGCACTTTTTGTGGCAAGCGTTCGTCATGCGGTTATATAAATCGGACATCATTTCGATCTCCATTTCCTGCATCAGCTGCAGCTTGGCCTGGTCTGCGGTGCTGATCTGGGGCAATGCC |
| "R" Primer: |
GGCATTGCCCCAGATCAG |
| "S" Primer: |
TCGGAGTAGCGCGGC |
| Amplicon Length: |
138 |
| Target Gene(s): |
Tim10, CG42497 |
| Potential Off-Target Number: |
1 |
| CAR/CAN repeats: |
None |
|
dsRNA Matches to Transcripts and Exons
|
|
|
| Transcript |
FBtr0071676 |
| Exon 2 length |
363 |
dsRNA Position Relative to Exon 2: 215 - 352 |
| Transcript |
FBtr0071677 |
| Exon 3 length |
427 |
dsRNA Position Relative to Exon 3: 279 - 416 |
| Transcript |
FBtr0300626 |
| Exon 2 length |
363 |
dsRNA Position Relative to Exon 2: 215 - 352 |
|
Historical Amplicon Information
|
|
|
| HFA Amplicon ID: |
HFA04664 |
| Amplicon Nickname: (Old Oligo Name) |
Tim10 |
|
Click
here for amplicon info documentation
|
|
Genomic Position Information (based on Flybase, release 5.28)
|
|
|
| Chromosome Length: |
|
 |
| Start: |
17576154 |
| End: |
17580291 |
|
|
|
Transgenic RNAi Project (TRiP) Fly Stocks (1)
|
|
|
|
Short Hairpin HMJ21312
|
|
|
|
General Hairpin Information
|
|
|
| TRiP #: |
HMJ21312 |
BDSC Stock #: |
53948 |
| Gene ID: |
CG9878,CG42497 |
Gene Name: |
Tim10,CG42497 |
| Vector: |
VALIUM20 |
Hairpin ID: |
SH011-H05 |
| Classifications: |
Transmembrane |
Sense Oligo: |
ctagcagtCCCGTTGTAGAGAATAAACCAtagttatattcaagcataTGGTTTATTCTCTACAACGGGgcg |
| Antisense Oligo: |
aattcgcCCCGTTGTAGAGAATAAACCAtatgcttgaatataactaTGGTTTATTCTCTACAACGGGactg |
| Insertion Location: |
attP40 |
Gene Information for
Tim10:
|
|
|
|
| Symbol: |
Tim10 |
Gene Name: |
Translocase of inner membrane 10 |
| Flybase ID: |
FBgn0027360 |
Entrez Gene: |
37478 |
| Synonyms: |
Dromel_CG9878_FBtr0071676_tim10_mORF, bs31d12.y1, CG9878, tim10, Translocase of inner membrane 10 |
| Old Flybase IDs: |
|
| NCBI Nucleotide Accs: |
AF150092, AI515064, AQ073571, AQ074120, AW943864, AY061513, BE662211, BH615117, BH615118, BH634785, BH740821 |
| NCBI Protein Accs: |
AAF46756, AAM70932, AAD39998, AAL29061 |
| UniProt Accs: |
|
| Gene Ontology IDs: |
GO:0015031, GO:0015450, GO:0005744, GO:0006626, GO:0050829, GO:0045824, GO:0042719, GO:0008565, GO:0045039 |
| Protein Domains: |
IPR004217, IPR027247 |
| Unigene ID: |
Dm.3119 |
| RefSeq IDs: |
|
| Homologene Group: |
Homologene:40845: Xenopus tropicalis - timm10, Caenorhabditis elegans - tin-10, Anopheles gambiae str. PEST - AgaP_AGAP010679, Danio rerio - timm10, Gallus gallus - TIMM10, Rattus norvegicus - Timm10, Mus musculus - Timm10, Bos taurus - TIMM10, Canis lupus familiaris - TIMM10, Macaca mulatta - TIMM10, Pan troglodytes - TIMM10, Homo sapiens - TIMM10 |
| Other External Accs: |
|
| Kc167: |
183.372 - Expressed |
BG3: |
32.3687 - Expressed |
| Clone 8: |
201.667 - Expressed |
S2-DRSC: |
163.934 - Expressed |
| S2R+: |
377.299 - Expressed |
