Drosophila RNAi Screening Center

DRSC >> Protocols >> dsRNA Synthesis

Protocol for dsRNA Synthesis

  1. Primer Designed dsRNA
    1. Template Selection
    2. PCR
    3. In vitro RNA Transcription
    4. dsRNA Purification, Quantification, & Storage
  2. dsRNA From Clones
    1. PCR
    2. In vitro RNA Transcription
    3. Purification, Quantification, & Storage
  3. Additional References

We routinely produce dsRNA by in vitro transcription of a PCR generated DNA template containing the T7 promoter sequence on both ends (I. Primer Designed dsRNA). It is also possible to produce dsRNA using PCR generated DNA templates containing either the T7 & SP6 or the T7 & T3 promoters on either end (II. dsRNA Fom Clones). This method is less efficient, especially when working on a large scale.

**All work should be done in a sterile, RNase free environment, using only sterile, RNase free solutions and materials, and while wearing gloves to reduce contamination.

I. Primer Designed dsRNA

A. Template Selection

Templates can be generated by PCR on cDNA (including ESTs from BDGP), genomic DNA, or first strand RT-cDNA. Most of the dsRNA should correspond to exons but dsRNA with two or more exons interrupted by introns will also work well. We generally aim for ~300-600 bp products although RNAi with products ranging from 150-3000bp have been shown to work. The target sequence should not contain complete 19-mer homology to other genes or your dsRNA could be non-specific. See Kulkarni, et. al. (PubMed Entry) for further details of the issues surrounding template selection.

We suggest using our SnapDragon tool for primer design. After choosing the primer sequence, add the T7 promoter sequence (TAATACGACTCACTATAGGG) to the 5' end of both primers.

B. PCR

RXN SETUP:

There are two types of PCR reactions you may be doing as a preparatory step for dsRNA synthesis. A PCR amplification from genomic DNA using synthesized oligos with a T7 sequence attached or a re-amplification of dilute PCR with just the T7 primers. For both reactions we use a 25µl reaction with 2µl (10µM) primers and 12.5µl of a 2X PCR Taq mix which has Taq polymerase, buffer salts and dNTPs already in it (we use Denville Scientific "choice taq mastermix" catalog # CB4070-8). What differs between the reactions is the amount of DNA added. For the gDNA setup, use 125-200ng. For dilute PCR use 1µl of dilution (good results have been achieved by using a dilution of up to 1:5000 of original full strength PCR however 1:100-1:250 is recommended. Only use such large dilution amounts if volume of dilute PCR is limited.)

RXN CONDITIONS:
  1. 95°C for 5 minutes
  2. 95°C for 30 seconds
  3. Anneal Temp for 30 seconds*
  4. 72°C for 30 seconds***
  5. Steps 2-4 35 Cycles
  6. 72°C for 5 minutes

* Anneal Temp Note: It is almost guaranteed that not all PCR reactions will work great on the first run. To get around this do a first run at 57°C and then for reactions that don’t work perform a series of reactions using a gradient to find the optimal Anneal Temp.

*** - Different taqs have different extension temperatures and rates…look at your specific taq characteristics and adjust accordingly. Also take note that if there are unusually long amplicons like 1000bp, extra time may be necessary.

GEL:

Check the results of the PCR reactions to make sure you have a band of the correct size and good quality as this is the single most important aspect of creating good high quality dsRNA. We run 5µl PCR product on a 0.7% agarose gel and use Invitrogen 1KB Plus Ladder.

C. In vitro RNA Transcription

We use the Ambion MEGAscript T7 kit (Cat.# : 1334) for the transcription reaction. We follow the Ambion MEGAscript kit protocol for Transcription Reaction Assembly but use 8 µl of PCR and no water template per 20 µl reaction and incubate 16 hours or overnight in a heat block or thermocycler. We also frequently use ½ reactions as they usually yield more than enough dsRNA for an individuals use and only use full reactions when making enough dsRNA for library plates. It is not necessary to purify the PCR template before transcription. Following incubation, we remove the DNA template with the DNase. Transcription and annealing occur simultaneously and no additional step is required to anneal the two complementary strands. If you want more dsRNA, scale up the reaction.

We confirm the dsRNA product is the correct size using a 0.7% agarose gel with TBE or TAE buffer and load 5µl of a 5:100 dilution.

D. dsRNA Purification, Quantification, & Storage

Purify using Qiagen's RNAeasy (#74104) or Ambion's NucAway Spin Columns (#10070). Ambion also has a MEGAclear column which is reported to work but has not been tested in this lab. When using Qiagen's RNAeasy columns, follow the RNA cleanup protocol and elute twice to maximize yield. Also, if you scale up the 20 µl reaction and are using Qiagen's RNAeasy columns, divide the reaction and purify in two or more columns in order to not overload a single column. If you are performing reactions in a 96 well format, purify the dsRNA in Millipore Multiscreen PCR plates (#MANU03050). In our opinion, the Qiagen RNAeasy 96 well plates often perform inconsistently and can be difficult to use.

Measure the OD 260 of 1:50 dilution. Calculate the concentration by measuring the OD 260 of 1:50 - 1:100 dilution. Then multiply the OD260 by the dilution factor and an extinction coefficient of 45 (dsRNA Concentration = OD260 x Diln. x 45). The standard output of 20 µl reaction is 80 - 200 µg, with 120 µg as a frequently observed value.

The dsRNA can be stored at -20°C, or at -70°C as a precipitate with 0.1x sodium acetate and 2.5x ethanol.

II. dsRNA From Clones

A. PCR

Templates can be generated by PCR using purified plasmid as a template. The entire inserted sequence can be amplified using T7 & SP6 or T7 & T3 promoter primers depending on the plasmid.

Check the PCR results to ensure that you have a band of the expected size.

B. In vitro RNA Transcription

We use the Ambion MEGAscript T7, T3, & SP6 kits (Cat.# : 1334, 1338, 1330) for the transcription reaction. With T7 & SP6 or T7 & T3 promoters, each transcription reaction will occur in a separate tube. Follow the Ambion MEGAscript kit protocol and use 5 µl of PCR template per 20 µl reaction. It is not necessary to purify the PCR template before transcription.

When the reactions are complete (generally after 2-4 hours) check 0.5 µl of each product on an agarose gel.

C. Purification, Quantification, & Storage

Purify each strand using Ambion's NucAway Spin Columns. I would not advise using the Qiagen RNAeasy columns due to the fact that the two strands never annealed after using them.

To anneal, combine equal molar amounts of each transcript into one tube. Then, place the tube in a boiling water bath, turn the heat off, and leave overnight to anneal. Check again on a 1% agarose gel, measure the concentration, aliquot, and store.

III. Additional References

Worby CA, Simonson-Leff N, Dixon JE. (2001) RNA interference of gene expression (RNAi) in cultured Drosophila cells. Sci STKE (95):PL1.

Dixon Lab -http://cmm.ucsd.edu/Lab_Pages/Dixon/protocols.php?RNAiExp

Carthew Lab - www.biochem.northwestern.edu/carthew/

www.ambion.com