|
DRSC
>> Protocols
>> dsRNA Synthesis
Protocol for dsRNA Synthesis
- Primer Designed dsRNA
- Template Selection
- PCR
- In vitro RNA Transcription
- dsRNA Purification, Quantification, &
Storage
- dsRNA From Clones
- PCR
- In vitro RNA Transcription
- Purification, Quantification, &
Storage
- Additional References
We routinely
produce dsRNA by in vitro transcription of a PCR generated DNA
template containing the T7 promoter sequence on both ends (I. Primer
Designed dsRNA). It is also possible to produce dsRNA using PCR
generated DNA templates containing either the T7 & SP6 or the T7
& T3 promoters on either end (II. dsRNA Fom Clones). This method
is less efficient, especially when working on a large scale.
**All work
should be done in a sterile, RNase free environment, using only
sterile, RNase free solutions and materials, and while wearing gloves
to reduce contamination.
I. Primer Designed dsRNA
A. Template Selection
Templates can be generated by PCR on cDNA (including ESTs
from BDGP), genomic DNA, or first strand RT-cDNA. Most of
the dsRNA should correspond to exons but dsRNA with two or
more exons interrupted by introns will also work well. We
generally aim for ~300-600 bp products although RNAi with
products ranging from 150-3000bp have been shown to
work. The target sequence should not contain complete
19-mer homology to other genes or your dsRNA could be
non-specific. See Kulkarni, et. al. ( ) for further
details of the issues surrounding template selection.
We suggest using our SnapDragon tool for primer design. After
choosing the primer sequence, add the T7 promoter sequence
(TAATACGACTCACTATAGGG) to the 5' end of both primers.
B. PCR
Perform a standard 50 or 100µl PCR reaction using
your selected primer sequences to amplify the region of
interest. Use 1-2 µl of a 10µM primer stock,
100-200 ng DNA as template and DNA polymerase. We have
successfully used GeneChoice Taq (PGC Scientifics
#62-6086-01), TaqPlus (Stratagene #600210), and Herculase
(Stratagene #NC9690330) in the following PCR reaction
conditions:
- 94°C - 3 min.
- 94°C - 45 sec.
- 57°C - 30 sec.
- 72°C - 45 sec.
- steps 2-4, 30x
- 72°C - 10 min.li
Check the PCR results to ensure that you have a band of
the expected size. We run 4µl in a 1% agarose gel and
use the small combs. We also us a 250bp ladder.
C. In vitro RNA
Transcription
We use the Ambion MEGAscript T7 kit (Cat.# : 1334) for
the transcription reaction. Follow the Ambion MEGAscript
kit protocol for Transcription Reaction Assembly and use 5
µl of PCR template per 20 µl reaction. It is
not necessary to purify the PCR template before
transcription. We incubate the reaction in a heat block or
thermocycler for 4 hours. Following incubation, we remove
the DNA template with the DNase. Transcription and
annealing occur simultaneously and no additional step is
required to anneal the two complementary strands. If you
want more dsRNA, scale up the reaction.
Confirm that the dsRNA product is the correct size using
a 1% agarose gel with TBE or TAE buffer and load only 0.5
µl.
D. dsRNA Purification, Quantification,
& Storage
Purify using Qiagen's RNAeasy (#74104) or Ambion's
NucAway Spin Columns (#10070). Ambion also has a MEGAclear
column which is reported to work but has not been tested in
this lab. When using Qiagen's RNAeasy columns, follow the
RNA cleanup protocol and elute twice to maximize yield.
Also, if you scale up the 20 µl reaction and are using
Qiagen's RNAeasy columns, divide the reaction and purify in
two or more columns in order to not overload a single
column. If you are performing reactions in a 96 well
format, purify the dsRNA in Millipore Multiscreen PCR plates
(#MANU03050). In our opinion, the Qiagen RNAeasy 96 well
plates often perform inconsistently and can be difficult to
use.
Measure the OD 260 of 1:50 dilution. Calculate the
concentration by measuring the OD 260 of 1:50 - 1:100
dilution. Then multiply the OD260 by the dilution factor
and an extinction coefficient of 45 (dsRNA Concentration =
OD260 x Diln. x 45). The standard output of 20 µl
reaction is 80 - 200 µg, with 120 µg as a
frequently observed value.
The dsRNA can be stored at -20°C, or at
-70°C as a precipitate with 0.1x sodium acetate
and 2.5x ethanol.
II. dsRNA From Clones
A. PCR
Templates can be generated by PCR using purified plasmid
as a template. The entire inserted sequence can be
amplified using T7 & SP6 or T7 & T3 promoter primers
depending on the plasmid.
Check the PCR results to ensure that you have a band of
the expected size.
B. In vitro RNA
Transcription
We use the Ambion MEGAscript T7, T3, & SP6 kits
(Cat.# : 1334, 1338, 1330) for the transcription
reaction. With T7 & SP6 or T7 & T3 promoters, each
transcription reaction will occur in a separate tube.
Follow the Ambion MEGAscript kit protocol and use 5 µl
of PCR template per 20 µl reaction. It is not
necessary to purify the PCR template before
transcription.
When the reactions are complete (generally after 2-4
hours) check 0.5 µl of each product on an agarose
gel.
C. Purification, Quantification, &
Storage
Purify each strand using Ambion's NucAway Spin Columns. I would
not advise using the Qiagen RNAeasy columns due to the fact that the
two strands never annealed after using them.
To anneal, combine equal molar amounts of each transcript into one
tube. Then, place the tube in a boiling water bath, turn the heat
off, and leave overnight to anneal. Check again on a 1% agarose gel,
measure the concentration, aliquot, and store.
III. Additional References
Worby CA, Simonson-Leff N, Dixon JE. (2001) RNA interference of
gene expression (RNAi) in cultured Drosophila cells. Sci STKE
(95):PL1.
Dixon Lab -http://cmm.ucsd.edu/Lab_Pages/Dixon/protocols.php?RNAiExp
Carthew Lab - www.biochem.northwestern.edu/carthew/
www.ambion.com
|